After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano HEXA clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human HEXA Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000520
Tamaño de cDNA:1590bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens hexosaminidase A (alpha polypeptide).
Sinónimo de gen:HEXA
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Referencias
  • Norflus,F. et al., 1996, DNA Cell Biol. 15 (2):89-97.
  • Kaufman M., et al., 1997, Hum. Mutat. 10:295-300.
  • Tanaka A., et al., 2003, J. Hum. Genet. 48:571-574.
  • Chen R., et al., 2009, J. Proteome Res. 8:651-661.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Catálogo: HG12037-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"