Pedido rápido

Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano HIST1H3A Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_003529.2
    Tamaño de cDNA:411bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens histone cluster 1, H3a with N terminal Flag tag.
    Sinónimo de gen:H3/A, H3FA, HIST1H3B, HIST1H3C, HIST1H3D, HIST1H3E, HIST1H3F, HIST1H3G, HIST1H3H, HIST1H3I, HIST1H3J, HIST1H3A
    Especie:Human
    Vector:pCMV3-N-FLAG
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HIST1H3A qPCR primers for gene expression analysis, HP101109 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11231-ACG$225
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11231-ACR$225
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11231-ANG$225
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11231-ANR$225
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11231-CF$195
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11231-CH$195
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11231-CM$195
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11231-CY$195
    Humano HIST1H3A clonación del ADN o clonación génica(Vector de expresión)HG11231-M$75
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11231-NF$195
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11231-NH$195
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11231-NM$195
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11231-NY$195
    Humano HIST1H3A clonación del ADN o clonación génica(vector de clonación)HG11231-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Histone H3.1, also known as HIST1H3A, HIST1H3B, HIST1H3C, HIST1H3D, HIST1H3E, HIST1H3F, HIST1H3G, HIST1H3H, HIST1H3I, HIST1H3J, is a member of the histone H3 family which is a core component of nucleosome. It is expressed during S phase, then expression strongly decreases as cell division slows down during the process of differentiation. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures.

    Referencias
  • Lachner M, et al., 2001, Nature 410 (6824): 116-20.
  • Koessler H, et al., 2003, DNA Cell Biol. 22 (4): 233-41.
  • Macdonald N. et al., 2005, Mol. Cell 20: 199-211.
  • Hyllus D. et al., 2007, Genes Dev. 21: 3369-3380.
  • Garcia BA. et al., 2007, J. Biol. Chem. 282:7641-7655.
  • Yu L.-R. et al., 2007, J. Proteome Res. 6: 4150-4162.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"