After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano HMG20A clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human HMG20A Información de producto de clon de cDNA
Gene_bank_ref_id:BC021959
Tamaño de cDNA:1044bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens high mobility group 20A.
Sinónimo de gen:FLJ10739, HMGX1, HMGXB1, HMG20A
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano HMG20A clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14212-ACG$225
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14212-ACR$225
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14212-ANG$225
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14212-ANR$225
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14212-CF$195
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14212-CH$195
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14212-CM$195
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14212-CY$195
Humano HMG20A clonación del ADN o clonación génica(Vector de expresión)HG14212-G$75
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14212-NF$195
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14212-NH$195
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14212-NM$195
Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14212-NY$195
Humano HMG20A clonación del ADN o clonación génica(vector de clonación)HG14212-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"