Pedido rápido

Humano HMG20A clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano HMG20A Información de producto de clon de cDNA
    Gene_bank_ref_id:BC021959
    Tamaño de cDNA:1044bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens high mobility group 20A.
    Sinónimo de gen:FLJ10739, HMGX1, HMGXB1, HMG20A
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HMG20A qPCR primers for gene expression analysis, HP102862 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación) on other vectors
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14212-ACG$225
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14212-ACR$225
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14212-ANG$225
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14212-ANR$225
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14212-CF$195
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14212-CH$195
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14212-CM$195
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14212-CY$195
    Humano HMG20A clonación del ADN o clonación génica(Vector de expresión)HG14212-G$75
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14212-NF$195
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14212-NH$195
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14212-NM$195
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14212-NY$195
    Humano HMG20A clonación del ADN o clonación génica(vector de clonación)HG14212-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG14212-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"