Pedido rápido

Text Size:AAA

Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human HMMR Información de producto de clon de cDNA
Tamaño de cDNA:2178bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens hyaluronan-mediated motility receptor (RHAMM) with N terminal His tag.
Sinónimo de gen:CD168, IHABP, RHAMM
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15961-ACG$245
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15961-ACR$245
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15961-ANG$245
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15961-ANR$245
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15961-CF$215
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15961-CH$215
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15961-CM$215
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15961-CY$215
Humano HMMR/RHAMM clonación del ADN o clonación génica(Vector de expresión)HG15961-G$75
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15961-NF$215
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15961-NH$215
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15961-NM$215
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15961-NY$215
Humano HMMR/RHAMM clonación del ADN o clonación génica(vector de clonación)HG15961-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15961-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.