After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano HNRNPM clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human HNRNPM Información de producto de clon de cDNA
Gene_bank_ref_id:BC000138
Tamaño de cDNA:2193bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein M.
Sinónimo de gen:CEAR, DKFZp547H118, HNRNPM4, HNRPM, HNRPM4, HTGR1, NAGR1, hnRNP M, HNRNPM
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14228-ACG$245
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14228-ACR$245
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14228-ANG$245
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14228-ANR$245
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14228-CF$215
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14228-CH$215
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14228-CM$215
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14228-CY$215
Humano HNRNPM clonación del ADN o clonación génica(Vector de expresión)HG14228-G$75
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14228-NF$215
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14228-NH$215
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14228-NM$215
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14228-NY$215
Humano HNRNPM clonación del ADN o clonación génica(vector de clonación)HG14228-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG14228-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"