Pedido rápido

Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano HOXD10 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC069619
    Tamaño de cDNA:1023bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens homeobox D10 with N terminal His tag.
    Sinónimo de gen:HOX4, HOX4D, HOX4E, Hox-4.4
    Especie:Human
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HOXD10 qPCR primers for gene expression analysis, HP104011 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15387-ACG$225
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15387-ACR$225
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15387-ANG$225
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15387-ANR$225
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15387-CF$195
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15387-CH$195
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15387-CM$195
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15387-CY$195
    Humano HOXD10 clonación del ADN o clonación génica(Vector de expresión)HG15387-G$75
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15387-NF$195
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15387-NH$195
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15387-NM$195
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15387-NY$195
    Humano HOXD10 clonación del ADN o clonación génica(vector de clonación)HG15387-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG15387-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"