After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human HSPB8 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_014365.2
Tamaño de cDNA:591bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens heat shock 22kDa protein 8.
Sinónimo de gen:H11, HMN2, CMT2L, DHMN2, E2IG1, HMN2A, HSP22, HSPB8
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HSPB8
Sitio de restricción:KpnI + XbaI (6.1kb + 0.59kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human HSPB8 Gene Plasmid Map
Human HSPB8 / Cryac Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10666-ACG$225
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10666-ACR$225
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10666-ANG$225
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10666-ANR$225
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10666-CF$195
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10666-CH$195
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10666-CM$195
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10666-CY$195
Humano HSPB8/Cryac clonación del ADN o clonación génica(Vector de expresión)HG10666-M$75
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10666-M-F$195
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10666-NF$195
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10666-NH$195
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10666-NM$195
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10666-NY$195
Humano HSPB8/Cryac clonación del ADN o clonación génica(vector de clonación)HG10666-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10666-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"