After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human HSPBAP1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC011897
Tamaño de cDNA:1467bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens HSPB (heat shock 27kDa) associated protein 1 with N terminal His tag.
Sinónimo de gen:PASS1
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14860-ACG$225
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14860-ACR$225
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14860-ANG$225
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14860-ANR$225
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14860-CF$195
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14860-CH$195
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14860-CM$195
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14860-CY$195
Humano HSPBAP1 clonación del ADN o clonación génica(Vector de expresión)HG14860-G$75
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14860-NF$195
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14860-NH$195
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14860-NM$195
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14860-NY$195
Humano HSPBAP1 clonación del ADN o clonación génica(vector de clonación)HG14860-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG14860-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"