Pedido rápido

Humano ICAM4 / CD242 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano ICAM4 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC000046
    Tamaño de cDNA:819bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens ?intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)? with C terminal Flag tag.
    Sinónimo de gen:LW, CD242, ICAM4
    Especie:Human
    Vector:pCMV3-C-FLAG
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ICAM4 qPCR primers for gene expression analysis, HP102032 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Fondo

    ICAM4, also known as CD242, is a member of the?immunoglobulin superfamily, ICAM family. ICAM4 contains 2?Ig-like C2-type (immunoglobulin-like) domains. It is similar to the intercellular adhesion molecule (ICAM) protein family. ICAM4 binds to the leukocyte adhesion LFA-1 protein. ICAM4's first reported receptors were CD11a/CD18 and CD11b/CD18. ICAM4 functions as a ligand for the monocyte/macrophage-specific CD11c/CD18. Deletion of the individual immunoglobulin domains of ICAM4 demonstrated that both its domains contain binding sites for CD11c/CD18. CD11c/CD18 is expressed on macrophages in spleen and bone marrow. Inhibition of erythrophagocytosis by anti-ICAM4 and anti-integrin antibodies suggests a role for these interactions in removal of senescent red cells.

    Referencias
  • Gorst DW. et al., 1980, Vox Sanguinis. 38 (2): 99-105.
  • Vos GH. et al., 1973, Blood. 42 (3): 445-53.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Daniels G. et al., 2002, Transfusion Medicine. 12 (5): 287-95.
  • Size / Price
    Catálogo: HG13327-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"