Pedido rápido

Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

  • Human Insulysin/insulin-degrading enzyme Gene Plasmid Map 15908
Hoja de datosReseñasProductos relacionadosProtocolos
Humano IDE Información de producto de clon de cDNA
Gene_bank_ref_id:BC096336
Tamaño de cDNA:3105 bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens insulin-degrading enzyme with N terminal His tag.
Sinónimo de gen:INSULYSIN
Especie:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-IDE
Sitio de restricción:KpnI(two restriction sites) + XbaI(6kb+3.06kb+0.06kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IDE qPCR primers for gene expression analysis, HP104565 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15978-ACG$325
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15978-ACR$325
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15978-CF$295
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15978-CH$295
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15978-CM$295
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15978-CY$295
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(Vector de expresión)HG15978-G$75
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15978-NF$295
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15978-NH$295
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15978-NM$295
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15978-NY$295
Humano Insulysin/insulin-degrading enzyme clonación del ADN o clonación génica(vector de clonación)HG15978-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"