Pedido rápido

Human IDH1 ORF mammalian expression plasmid, C-His tag

Hoja de datosReseñasProductos relacionadosProtocolos
Human IDH1 Información de producto de clon de cDNA
Tamaño de cDNA:1245bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens isocitrate dehydrogenase 1 (NADP+), soluble with C terminal His tag.
Sinónimo de gen:IDH, IDP, IDCD, IDPC, PICD, IDH1
Sitio de restricción:KpnI + XbaI (6kb + 1.29kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human IDH1 Gene Plasmid Map
Human IDH1 natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
  • Takano S, et al. (2011) Detection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing. Brain Tumor Pathol. 28(2): 115-23.
  • Geisbrecht BV, et al. (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP(+)-dependent isocitrate dehydrogenase. J Biol Chem. 274(43): 30527-30533.
  • Nekrutenko A, et al. (1998) Cytosolic isocitrate dehydrogenase in humans, mice, and voles and phylogenetic analysis of the enzyme family. Mol Biol Evol. 15(12): 1674-1684.
  • Henke B, et al. (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids. J Biol Chem. 273(6): 3702-3711.
  • Gabriel JL, et al. (1986) Activity of purified NAD-specific isocitrate dehydrogenase at modulator and substrate concentrations approximating conditions in mitochondria. Metabolism. 35(7): 661-667.
  • Size / Price
    Catálogo: HG12055-CH
    Precio de lista:   (Save )
    Precio:      [How to order]
     Instrucciones de envío
    • Human IDH1 natural ORF mammalian expression plasmid, C-His tag
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.