After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IDO1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_002164.4
Tamaño de cDNA:1212bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens indoleamine 2,3-dioxygenase 1 with C terminal Flag tag.
Sinónimo de gen:IDO, INDO, IDO1
Especie:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-IDO1-Flag
Sitio de restricción:KpnI + XbaI (6kb + 1.25kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human IDO1 Gene Plasmid Map
Human IDO1 natural ORF mammalian expression plasmid, C-Flag tag
Human IDO1 Gene Expression validated Image
Human IDO1 ORF mammalian expression plasmid, C-Flag tag
[Hacer clic para ampliar la imagen]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11650-ACG$225
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11650-ACR$225
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11650-ANG$225
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11650-ANR$225
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11650-CF$195
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11650-CH$195
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11650-CM$195
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11650-CY$195
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(Vector de expresión)HG11650-M$75
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11650-NF$195
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11650-NH$195
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11650-NM$195
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11650-NY$195
Humano IDO1/Indoleamine 2,3‑dioxygenase clonación del ADN o clonación génica(vector de clonación)HG11650-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Indoleamine 2,3-dioxygenase-1, also known as Indoleamine-pyrrole 2,3-dioxygenase, IDO1 and IDO, is a member of the indoleamine 2,3-dioxygenase family. IDO1 / IDO and tryptophan 2,3-dioxygenase (TDO) are tryptophan-degrading enzymes that catalyze the first step in tryptophan catabolism via the kynurenine pathway. TDO is widely distributed in both eukaryotes and bacteria. In contrast, IDO has been found only in mammals and yeast. In 2007, a third enzyme, indoleamine 2,3-dioxygenase-2 (IDO2), was discovered. IDO2 is found not only in mammals but also in lower vertebrates. IDO1 / IDO is an immunosuppressive molecule inducible in various cells. IDO1 / IDO catalyzes the cleavage of the pyrrol ring of tryptophan and incorporates both atoms of a molecule of oxygen. It mediates oxidative cleavage of tryptophan, an amino acid essential for cell proliferation and survival. IDO1 / IDO inhibition is proposed to have therapeutic potential in immunodeficiency-associated abnormalities, including cancer. The IDO pathway is activated in multiple tumor types. Selective inhibition of IDO1 may represent an attractive cancer therapeutic strategy via up-regulation of cellular immunity. IDO1 / IDO is an enzyme that suppresses adaptive T-cell immunity by catabolizing tryptophan from the cellular microenvironment. Inhibition of IDO pathway might enhance the efficacy of immunotherapeutic strategies for cancer.

Referencias
  • Barnes NA. et al., 2009, J Immunol. 183 (9): 5768-77.
  • Yuasa HJ. et al., 2009, Comp Biochem Physiol B Biochem Mol Biol. 153 (2): 137-44.
  • L b S. et al., 2009, Cancer Immunol Immunother. 58 (1): 153-7.
  • Liu,X. et al., 2010, Blood.115 (17): 3520-30.
  • Sun,T. et al., 2010, Mol Cell Biochem. 342 (1-2): 29-34.
  • Kiank C. et al., 2010, PLoS One. 5 (7): e11825.
  • Size / Price
    Catálogo: HG11650-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human IDO1 natural ORF mammalian expression plasmid, C-Flag tag
    • Human IDO1 ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"