IDO cDNA ORF Clone, Human, N-HA tag

1/1
Price:
Size:
Number:

IDO cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human indoleamine 2,3-dioxygenase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.25kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IDO cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IDO cDNA ORF Clone, Human, N-HA tag: Validated Images

IDO cDNA ORF Clone, Human, N-HA tag: Alternative Names

IDO cDNA ORF Clone, Human; IDO-1 cDNA ORF Clone, Human; INDO cDNA ORF Clone, Human; Indoleamine 2,3‑dioxygenase cDNA ORF Clone, Human

IDO Background Information

Indoleamine 2,3-dioxygenase-1, also known as Indoleamine-pyrrole 2,3-dioxygenase, IDO1 and IDO, is a member of the indoleamine 2,3-dioxygenase family. IDO1 / IDO and tryptophan 2,3-dioxygenase (TDO) are tryptophan-degrading enzymes that catalyze the first step in tryptophan catabolism via the kynurenine pathway. TDO is widely distributed in both eukaryotes and bacteria. In contrast, IDO has been found only in mammals and yeast. In 27, a third enzyme, indoleamine 2,3-dioxygenase-2 (IDO2), was discovered. IDO2 is found not only in mammals but also in lower vertebrates. IDO1 / IDO is an immunosuppressive molecule inducible in various cells. IDO1 / IDO catalyzes the cleavage of the pyrrol ring of tryptophan and incorporates both atoms of a molecule of oxygen. It mediates oxidative cleavage of tryptophan, an amino acid essential for cell proliferation and survival. IDO1 / IDO inhibition is proposed to have therapeutic potential in immunodeficiency-associated abnormalities, including cancer. The IDO pathway is activated in multiple tumor types. Selective inhibition of IDO1 may represent an attractive cancer therapeutic strategy via up-regulation of cellular immunity. IDO1 / IDO is an enzyme that suppresses adaptive T-cell immunity by catabolizing tryptophan from the cellular microenvironment. Inhibition of IDO pathway might enhance the efficacy of immunotherapeutic strategies for cancer.
Full Name
indoleamine 2,3-dioxygenase 1
References
  • Barnes NA. et al., 2009, J Immunol. 183 (9): 5768-77.
  • Yuasa HJ. et al., 2009, Comp Biochem Physiol B Biochem Mol Biol. 153 (2): 137-44.
  • L b S. et al., 2009, Cancer Immunol Immunother. 58 (1): 153-7.
  • Liu,X. et al., 2010, Blood.115 (17): 3520-30.
  • Sun,T. et al., 2010, Mol Cell Biochem. 342 (1-2): 29-34.
  • Kiank C. et al., 2010, PLoS One. 5 (7): e11825.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait