Pedido rápido

Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

  • Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
Hoja de datosReseñasProductos relacionadosProtocolos
Humano IFIH1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC046208
Tamaño de cDNA:711 bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interferon induced with helicase C domain 1 with N terminal His tag.
Sinónimo de gen:Hlcd, MDA5, MDA-5, RLR-2, IDDM19
Especie:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-IFIH1
Sitio de restricción:KpnI + XbaI(6kb+0.71kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IFIH1 qPCR primers for gene expression analysis, HP104013 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15389-ACG$225
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15389-ACR$225
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15389-ANG$225
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15389-ANR$225
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15389-CF$195
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15389-CH$195
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15389-CM$195
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15389-CY$195
Humano MDA5/IFIH1 clonación del ADN o clonación génica(Vector de expresión)HG15389-G$75
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15389-NF$195
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15389-NH$195
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15389-NM$195
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15389-NY$195
Humano MDA5/IFIH1 clonación del ADN o clonación génica(vector de clonación)HG15389-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15389-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"