After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano IFNA7 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IFNA7 Información de producto de clon de cDNA
Tamaño de cDNA:570bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interferon, alpha 7 with C terminal Flag tag.
Sinónimo de gen:IFNA-J
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interferon alpha-7(IFNA7) is a member of the interferon family. Interferons belong to the group of the regulatory glycoproteins, of low molecular mass. They are the products of infected cell-genome, but not virus, as a consequence of the cause answer by different inductors. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs have other functions: they activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they increase the ability of uninfected host cells to resist new infection by virus. Certain host symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Human IFN are divided on the sequence of amino-acids into three groups: Alpha, Beta and Gamma interferons.

  • De Veer MJ, et al. (2001) Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol. 69 (6): 912-20.
  • Liu YJ. (2005) IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu Rev Immunol. 23: 275-306.
  • Fensterl V, et al. (2009) Interferons and viral infections. Biofactors. 35 (1): 14-20.

    IFNA7 related areas, pathways, and other information

    Size / Price
    Catálogo: HG10341-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.