After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IFNA8 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_002170.3
Tamaño de cDNA:570bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interferon, alpha 8 with C terminal Flag tag.
Sinónimo de gen:IFNA8
Especie:Human
Vector:pCMV3-C-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10347-ACG$225
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10347-ACR$225
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10347-CF$195
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10347-CH$195
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10347-CM$195
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10347-CY$195
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(Vector de expresión)HG10347-M$75
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10347-M-F$195
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10347-NF$195
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10347-NH$195
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10347-NM$195
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10347-NY$195
Humano Interferon alpha-B / IFNA8 clonación del ADN o clonación génica(vector de clonación)HG10347-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Interferon alpha-B, also known as IFNA8, belongs to the alpha/beta interferon family. Interferons are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumorcells. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They also allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. Interferons also activate immune cells, such as natural killer cells and macrophages. They increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes. They also increase the ability of uninfected host cells to resist new infection by virus. Certain symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Produced by macrophages, IFN-alpha have antiviral activities.

Referencias
  • Henco K. et al., 1985, J Mol Biol. 185 (2): 227-60.
  • Goeddel DV. et al., 1981, Nature. 290 (5801): 20-6.
  • Yelverton E. et al., 1981, Nucleic Acids Res. 9 (3): 731-41.
  • Kempaiah P. et al., 2012, Hum Genet. 131 (8): 1375-91.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"