Pedido rápido

Text Size:AAA

Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IGF2BP2 Información de producto de clon de cDNA
Tamaño de cDNA:1800bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens insulin-like growth factor 2 mRNA binding protein 2 with C terminal His tag.
Sinónimo de gen:p62, IMP2, IMP-2, VICKZ2
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11116-ACG$245
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11116-ACR$245
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11116-ANG$245
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11116-ANR$245
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11116-CF$215
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11116-CH$215
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11116-CM$215
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11116-CY$215
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(Vector de expresión)HG11116-M$75
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11116-M-F$215
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11116-NF$215
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11116-NH$215
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11116-NM$215
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11116-NY$215
Humano IGF2BP2/IMP2 clonación del ADN o clonación génica(vector de clonación)HG11116-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is a member of the IGF-II mRNA-binding protein (IMP) family. IGF2BP2 is a member of a family of mRNA binding proteins that, collectively, have been shown to bind to several different mRNAs in mammalian cells, including one of the mRNAs encoding insulin-like growth factor-2. Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is involved in the stimulation of insulin action. IGF2BP2 / IMP2 is expressed in oocytes, granulosa cells of small and growing follicles, Leydig cells, spermatogonia and semen (at protein level). It is also expressed in testicular cancer (at protein level). It is expressed weakly in heart, placenta, skeletal muscle, bone marrow, colon, kidney, salivary glands, testis and pancreas. IGF2BP2 binds to the 5'-UTR of the insulin-like growth factor 2 (IGF2) mRNAs. This binding is isoform-specific. IGF2BP2 may regulate translation of target mRNAs.

  • Omori S, et al. (2008) Association of CDKAL1, IGF2BP2, CDKN2A/B, HHEX, SLC30A8, and KCNJ11 with susceptibility to type 2 diabetes in a Japanese population. Diabetes. 57(3): 791-5.
  • Grarup N, et al. (2007) Studies of association of variants near the HHEX, CDKN2A/B, and IGF2BP2 genes with type 2 diabetes and impaired insulin release in 10,705 Danish subjects: validation and extension of genome-wide association studies. Diabetes. 56(12): 3105-11.
  • Wu Y, et al. (2008) Common variants in CDKAL1, CDKN2A/B, IGF2BP2, SLC30A8, and HHEX/IDE genes are associated with type 2 diabetes and impaired fasting glucose in a Chinese Han population. Diabetes. 57(10): 2834-42.
  • Size / Price
    Catálogo: HG11116-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.