Pedido rápido

Humano IGFBP7 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IGFBP7 Información de producto de clon de cDNA
Tamaño de cDNA:849bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens insulin-like growth factor binding protein 7 with N terminal Myc tag.
Sinónimo de gen:AGM, PSF, TAF, FSTL2, IBP-7, MAC25, IGFBP-7, IGFBP-7v, IGFBPRP1, IGFBP7
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Insulin like growth factor binding protein 7 (IGFBP7) is a member of the IGFBP family. It has been identified in colorectal adenocarcinoma (CRC) cell lines. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGFBP7 could inhibit cell growth, decrease soft agar colony formation activity and induce apoptosis in RKO and SW620 cells. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.

  • Oh Y, et al. (1996) Synthesis and characterization of insulin-like growth factor-binding protein (IGFBP)-7. Recombinant human mac25 protein specifically binds IGF-I and -II. J Biol Chem. 271(48): 30322-5.
  • Wilson EM, et al. (1997) Generation and characterization of an IGFBP-7 antibody: identification of 31kD IGFBP-7 in human biological fluids and Hs578T human breast cancer conditioned media. J Clin Endocrinol Metab. 82(4): 1301-3.
  • Lin J, et al. (2007) Methylation patterns of IGFBP7 in colon cancer cell lines are associated with levels of gene expression. J Pathol. 212(1): 83-90.
  • Size / Price
    Catálogo: HG13100-NM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.