Pedido rápido

Humano IL17A/IL-17A/IL17 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IL17A Información de producto de clon de cDNA
Tamaño de cDNA:468bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interleukin 17A with C terminal His tag.
Sinónimo de gen:IL-17A, IL-17
Sitio de restricción:KpnI + XbaI (6kb + 0.51kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human IL17A Gene Plasmid Map
Human IL17A natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano IL17A/IL-17A/IL17 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Product nameProduct name

IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.

  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.
  • Size / Price
    Catálogo: HG12047-CH
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human IL17A natural ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.