Pedido rápido

Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IL17RB Información de producto de clon de cDNA
Gene_bank_ref_id:NM_018725.3
Tamaño de cDNA:1509bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interleukin 17 receptor B with N terminal Myc tag.
Sinónimo de gen:CRL4, EVI27, IL17BR, IL17RH1, MGC5245
Especie:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13091-ACG$245
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13091-ACR$245
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13091-CF$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13091-CH$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13091-CM$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13091-CY$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(Vector de expresión)HG13091-M$75
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13091-M-F$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13091-NF$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13091-NH$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13091-NM$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13091-NY$215
Humano IL17BR / IL17RB / IL-17 Receptor B clonación del ADN o clonación génica(vector de clonación)HG13091-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Referencias
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Catálogo: HG13091-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"