After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IL1RAPL2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_017416.1
Tamaño de cDNA:2061bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interleukin 1 receptor accessory protein-like 2 (IL1RAPL2) with N terminal Myc tag.
Sinónimo de gen:IL1RAPL2, IL1R9, IL-1R9, TIGIRR-1, IL1RAPL-2
Especie:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10156-ACG$245
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10156-ACR$245
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10156-CF$215
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10156-CH$215
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10156-CM$215
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10156-CY$215
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(Vector de expresión)HG10156-M$75
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10156-M-F$215
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10156-NF$215
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10156-NH$215
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10156-NM$215
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10156-NY$215
Humano IL-1R9/IL1RAPL2 clonación del ADN o clonación génica(vector de clonación)HG10156-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

X-linked interleukin-1 receptor accessory protein-like 2 (IL1RAPL2) or Interleukin-1 receptor 9 (IL-1R9) is a member of the interleukin 1 receptor family. This protein is similar to the interleukin 1 accessory proteins. IL-1R9/IL1RAPL2 shows restricted expression in fetal brain and is highly homologous to IL1RAPL, which is reportedly involved in nonsyndromic X-linked mental retardation. IL-1R9/IL1RAPL2 is highly homologous to IL-1R8. Both forms have no known ligands and receptor are found in the fetal brain. IL-1R9/IL1RAPL2 may function as a negative receptor. Both IL1RAPL1 and IL1RAPL2 have novel C-terminal sequences not present in other related proteins. IL-1R9/IL1RAPL2 may be strong candidates for X-linked non-syndromic mental retardation loci, and that molecules resembling IL-1 and IL-18 play a role in the development or function of the central nervous system.

Referencias
  • Jin H, et al. (2000) Two novel members of the interleukin-1 receptor gene family, one deleted in Xp22.1-Xp21.3 mental retardation. Eur J Hum Genet. 8(2): 87-94.
  • Sana TR, et al. (2000) Computational identification, cloning, and characterization of IL-1R9, a novel interleukin-1 receptor-like gene encoded over an unusually large interval of human chromosome Xq22.2-q22.3. Genomics. 69(2): 252-62.
  • Gambino F, et al. (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci. 104(21): 9063-8.
  • Size / Price
    Catálogo: HG10156-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"