After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IL1RL1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_003856.2
Tamaño de cDNA:987bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interleukin 1 receptor-like 1, transcript variant 2 with N terminal His tag.
Sinónimo de gen:IL1RL1, T1, ST2, DER4, ST2L, ST2V, FIT-1, MGC32623
Especie:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-IL1RL1
Sitio de restricción:KpnI + NotI (6kb + 1.03kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human IL1RL1 Gene Plasmid Map
Human IL1RL1 / ST2 transcript variant 2 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10105-ACG$225
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10105-ACR$225
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10105-CF$195
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10105-CH$195
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10105-CM$195
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10105-CY$195
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)HG10105-M$75
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10105-NF$195
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10105-NH$195
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10105-NM$195
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10105-NY$195
Humano IL1RL1/IL‑1 R4 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG10105-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

IL-1 receptor–like 1 (IL1RL1) is a membrane receptor involved in TH2 inflammatory responses and eosinophilia. It has previously been described that levels of the interlukin-1 like 1 (IL1RL1) protein can be used to diagnose cardiovascular disease and determine the prognosis for a patient with cardiovascular disease. The ligand for IL1RL1 has been described, and named IL-33. Mutants in IL1RL1 have been associated with blood eosinophil counts in a genome-wide association study and with asthma in family-based and case-control studies. As an important mediator involved in many immune and inflammatory responses, this cytokine has been implicated as a regulator of both the development and effector phases of type 2 helper T cell responses, and as a negative feedback modulator of macrophage pro-inflammatory function. IL33 is a specific ligand of ST2L and induces production of Th2 cytokines.

Referencias
  • Savenije OE, et al. (2011) Interleukin-1 receptor-like 1 polymorphisms are associated with serum IL1RL1-a, eosinophils, and asthma in childhood. J Allergy Clin Immunol. 127(3): 750-6.
  • Li H, et al. (2000) The cloning and nucleotide sequence of human ST2L cDNA. Genomics. 67(3): 284-90.
  • Size / Price
    Catálogo: HG10105-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human IL1RL1 / ST2 transcript variant 2 natural ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"