After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IL36B Información de producto de clon de cDNA
Tamaño de cDNA:474bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interleukin 1 family, member 8 (eta), transcript variant 2 with C terminal Myc tag.
Sinónimo de gen:FIL1, FIL1H, IL1H2, IL-1F8, IL-1H2, IL1-ETA, MGC126880, MGC126882, FIL1-(ETA)
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10579-ACG$225
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10579-ACR$225
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10579-CF$195
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10579-CH$195
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10579-CM$195
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10579-CY$195
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)HG10579-M$75
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10579-M-F$195
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10579-NF$195
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10579-NH$195
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10579-NM$195
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10579-NY$195
Humano IL36B/IL1F8 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG10579-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Interleukin-1 family member 8(IL1F8) also known as IL36B, is a member of the interleukin 1(IL-1) cytokine family. IL1F8 may contains a 12-stranded beta-trefoil structure. Until recently, the IL-1 family of cytokines includ four members, with three having pro-inflammatory effects such as IL1F8 and the fourth member being an IL-1 receptor antagonist (IL-1Ra). IL-1 family members exert their effects through binding to receptors that belong to the IL-1 receptor (IL-1R) family. IL1F8 exerts proinflammatory effects in primary human joint cells. Joint and serum IL-1F8 protein levels did not correlate with inflammation, but they were high in some human serum samples tested, including samples from patients with rheumatoid arthritis. IL1F8 also activated NK-κB.

  • Magne D, et al. (2006) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. Arthritis Research & Therapy. 8: R80.
  • Smith DE, et al. (2000) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. The Journal of Biological Chemistry. 275: 1169-75.
  • Size / Price
    Catálogo: HG10579-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.