Pedido rápido

Humano IL3RA/CD123 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

  • Rhesus CD3d/CD3 delta Gene Plasmid Map 5616
Hoja de datosReseñasProductos relacionadosProtocolos
Humano IL3RA Información de producto de clon de cDNA
Tamaño de cDNA:1173 bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interleukin 3 receptor, alpha (low affinity) with N terminal HA tag.
Sinónimo de gen:IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra, MGC34174
Sitio de restricción:KpnI + XbaI(6kb+1.17kb)
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
( We provide with IL3Ra qPCR primers for gene expression analysis, HP100062 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Interleukin-3 receptor subunit alpha, also known as IL-3 receptor subunit alpha, IL-3R-alpha, CD123, and IL3RA, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 5 subfamily. The specific alpha subunit of the interleukin-3 receptor (IL-3Ralpha, CD123) is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. The WSXWS motif of IL3RA appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box one motif of IL3RA is required for JAK interaction and / or activation. IL3RA represents a unique marker for primitive leukemic stem cells. Targeting of IL3RA may be a promising strategy for the preferential ablation of AML cells. Aberrant IL3RA expression is a good marker for monitoring of minimal residual disease. IL3RA is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. Recent studies have shown that interleukin-3 receptor alpha (CD123) is highly expressed on leukemia stem cells of patients with acute myeloid leukemia, and is correlated with tumor load and poor prognosis. CD123 was highly expressed in the bone marrow of the patients with myelodysplastic syndrome (MDS), significantly correlated with the proportion of bone marrow blasts, and thus might be the marker of MDS malignant clone. IL3RA is also a useful new marker for distinguishing B-cell disorders with circulating villous lymphocytes as its expression is characteristic of typical hairy cell leukemia (HCL) with high sensitivity and specificity.

  • Del Giudice I, et al. (2004) The diagnostic value of CD123 in B-cell disorders with hairy or villous lymphocytes. Haematologica. 89(3): 303-8.
  • Du X, et al. (2007) New immunotoxins targeting CD123, a stem cell antigen on acute myeloid leukemia cells. J Immunother. 30(6): 607-13.
  • Yue LZ, et al. (2010) Expression of CD123 and CD114 on the bone marrow cells of patients with myelodysplastic syndrome. Chin Med J (Engl). 123(15): 2034-2037.
  • Size / Price
    Catálogo: HG10518-NY
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.