After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano ING5 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ING5 Información de producto de clon de cDNA
Tamaño de cDNA:723bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens inhibitor of growth family, member 5 with N terminal Myc tag.
Sinónimo de gen:p28ING5
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano ING5 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Product nameProduct name

ING5 belongs to the ING family. It contains 1 PHD-type zinc finger and is a component of the HBO1 complex. HBO1 complex has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. HBO1 complex composed at least of ING4 or ING5, KAT7/HBO1, MEAF6, and one of PHF15, PHF16 and PHF17. ING5 also is a component of the MOZ/MORF complex which is composed at least of ING5, KAT6A, KAT6B, MEAF6 and one of BRPF1, BRD1/BRPF2 and BRPF3. It interacts with EP300 and TP53. MOZ/MORF complex has a histone H3 acetyltransferase activity. Through chromatin acetylation ING5 may regulate DNA replication and may function as a transcriptional coactivator. It interacts with H3K4me3 and to a lesser extent with H3K4me2. ING5 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. It can bind TP EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in TP53-dependent regulatory pathway.

  • Zhang F, et al. (2011) The inhibitor of growth protein 5 (ING5) depends on INCA1 as a co-factor for its antiproliferative effects. PLoS One. (7):e21505.
  • Zheng HC, et al. (2011) The nuclear to cytoplasmic shift of ING5 protein during colorectal carcinogenesis with their distinct links to pathologic behaviors of carcinomas. Hum Pathol. 42(3):424-33.
  • Xing YN, et al. (2011) The altered expression of ING5 protein is involved in gastric carcinogenesis and subsequent progression. Hum Pathol. 42(1):25-35.
  • Size / Price
    Catálogo: HG15462-NM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.