ING5 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

ING5 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Human inhibitor of growth family, member 5 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ING5 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

p28ING5 cDNA ORF Clone, Human

ING5 Background Information

ING5 belongs to the ING family. It contains 1 PHD-type zinc finger and is a component of the HBO1 complex. HBO1 complex has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. HBO1 complex composed at least of ING4 or ING5, KAT7/HBO1, MEAF6, and one of PHF15, PHF16 and PHF17. ING5 also is a component of the MOZ/MORF complex which is composed at least of ING5, KAT6A, KAT6B, MEAF6 and one of BRPF1, BRD1/BRPF2 and BRPF3. It interacts with EP3 and TP53. MOZ/MORF complex has a histone H3 acetyltransferase activity. Through chromatin acetylation ING5 may regulate DNA replication and may function as a transcriptional coactivator. It interacts with H3K4me3 and to a lesser extent with H3K4me2. ING5 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. It can bind TP EP3/p3, a component of the histone acetyl transferase complex, suggesting its involvement in TP53-dependent regulatory pathway.
Full Name
inhibitor of growth family, member 5
References
  • Zhang F, et al. (2011) The inhibitor of growth protein 5 (ING5) depends on INCA1 as a co-factor for its antiproliferative effects. PLoS One. (7):e21505.
  • Zheng HC, et al. (2011) The nuclear to cytoplasmic shift of ING5 protein during colorectal carcinogenesis with their distinct links to pathologic behaviors of carcinomas. Hum Pathol. 42(3):424-33.
  • Xing YN, et al. (2011) The altered expression of ING5 protein is involved in gastric carcinogenesis and subsequent progression. Hum Pathol. 42(1):25-35.

ING5 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed