ING5 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13917-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ING5 Reagents

CRO Services

Product recommended


All ING5 Reagents

ING5 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Human inhibitor of growth family, member 5 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ING5 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

p28ING5 cDNA ORF Clone, Human

ING5 Background Information

ING5 belongs to the ING family. It contains 1 PHD-type zinc finger and is a component of the HBO1 complex. HBO1 complex has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. HBO1 complex composed at least of ING4 or ING5, KAT7/HBO1, MEAF6, and one of PHF15, PHF16 and PHF17. ING5 also is a component of the MOZ/MORF complex which is composed at least of ING5, KAT6A, KAT6B, MEAF6 and one of BRPF1, BRD1/BRPF2 and BRPF3. It interacts with EP300 and TP53. MOZ/MORF complex has a histone H3 acetyltransferase activity. Through chromatin acetylation ING5 may regulate DNA replication and may function as a transcriptional coactivator. It interacts with H3K4me3 and to a lesser extent with H3K4me2. ING5 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. It can bind TP EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in TP53-dependent regulatory pathway.

Full Name
inhibitor of growth family, member 5
References
  • Zhang F, et al. (2011) The inhibitor of growth protein 5 (ING5) depends on INCA1 as a co-factor for its antiproliferative effects. PLoS One. (7):e21505.
  • Zheng HC, et al. (2011) The nuclear to cytoplasmic shift of ING5 protein during colorectal carcinogenesis with their distinct links to pathologic behaviors of carcinomas. Hum Pathol. 42(3):424-33.
  • Xing YN, et al. (2011) The altered expression of ING5 protein is involved in gastric carcinogenesis and subsequent progression. Hum Pathol. 42(1):25-35.
  • ING5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ING5 cDNA ORF Clone in Cloning Vector, Human HG13917-G
    ING5 cDNA ORF Clone in Cloning Vector, Human HG15462-G
    ING5 cDNA ORF Clone, Human, untagged HG15462-UT
    ING5 cDNA ORF Clone, Human, untagged HG13917-UT
    ING5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13917-ACGLN
    ING5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15462-ACGLN
    ING5 cDNA ORF Clone, Human, C-GFPSpark® tag HG13917-ACG
    ING5 cDNA ORF Clone, Human, C-GFPSpark® tag HG15462-ACG
    ING5 cDNA ORF Clone, Human, N-GFPSpark® tag HG13917-ANG
    ING5 cDNA ORF Clone, Human, N-GFPSpark® tag HG15462-ANG
    ING5 cDNA ORF Clone, Human, C-OFPSpark® tag HG15462-ACR
    ING5 cDNA ORF Clone, Human, C-OFPSpark® tag HG13917-ACR
    ING5 cDNA ORF Clone, Human, N-OFPSpark® tag HG15462-ANR
    ING5 cDNA ORF Clone, Human, N-OFPSpark® tag HG13917-ANR
    ING5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15462-CF
    ING5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13917-NF
    ING5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15462-NF
    ING5 cDNA ORF Clone, Human, C-His tag HG13917-CH
    ING5 cDNA ORF Clone, Human, C-His tag HG15462-CH
    ING5 cDNA ORF Clone, Human, N-His tag HG15462-NH
    ING5 cDNA ORF Clone, Human, N-His tag HG13917-NH
    ING5 cDNA ORF Clone, Human, C-HA tag HG13917-CY
    ING5 cDNA ORF Clone, Human, C-HA tag HG15462-CY
    ING5 cDNA ORF Clone, Human, N-HA tag HG13917-NY
    ING5 cDNA ORF Clone, Human, N-HA tag HG15462-NY
    ING5 cDNA ORF Clone, Human, C-Myc tag HG15462-CM
    ING5 cDNA ORF Clone, Human, C-Myc tag HG13917-CM
    ING5 cDNA ORF Clone, Human, N-Myc tag HG15462-NM
    ING5 cDNA ORF Clone, Human, N-Myc tag HG13917-NM
    ING5 qPCR Primer Pairs, Human HP102581
    info info
    添加购物车成功! 添加购物车失败!