After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human JTB Información de producto de clon de cDNA
Gene_bank_ref_id:BC000499
Tamaño de cDNA:441bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens jumping translocation breakpoint with C terminal HA tag.
Sinónimo de gen:PAR, hJT, HJTB, HSPC222, JTB
Especie:Human
Vector:pCMV3-C-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13447-ACG$225
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13447-ACR$225
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13447-CF$195
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13447-CH$195
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13447-CM$195
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13447-CY$195
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(Vector de expresión)HG13447-G$75
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13447-NF$195
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13447-NH$195
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13447-NM$195
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13447-NY$195
Humano jumping translocation breakpoint / JTB clonación del ADN o clonación génica(vector de clonación)HG13447-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Jumping translocation breakpoint, also known as JTB, is a member of the JTB family. Jumping translocation (JT) is an unbalanced translocation that comprises amplified chromosomalsegments jumping to various telomeres. JTB is expressed in all normal human tissues studied but overexpressed or underexpressed in many of their malignant counterparts. It is required for normal cytokinesis during mitosis. JTB plays a role in the regulation of cell proliferation. It may be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly.

Referencias
  • Hatakeyama S. et al., 1999, Oncogene. 18 (12): 2085-90.
  • Platica O. et al., 2000, Int J Oncol. 16 (5): 1055-61.
  • Erhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catálogo: HG13447-CY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"