Cytokeratin 19 / KRT19 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

Cytokeratin 19 / KRT19 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1203 bp
Description
Full length Clone DNA of Human keratin 19.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cytokeratin 19 / KRT19 cDNA ORF Clone, Human, untagged: Alternative Names

CK19 cDNA ORF Clone, Human; K19 cDNA ORF Clone, Human; K1CS cDNA ORF Clone, Human

Cytokeratin 19 / KRT19 Background Information

Cytokeratin 19 (KRT19) is a cytoplasmic intermediate filament protein, which is responsible for structural rigidity and multipurpose scaffolds. In several cancers, KRT19 is overexpressed and may play a crucial role in tumorigenic transformation.The KRT19 gene encodes cytokeratin 19, an element of the cytoskeleton whose expression is frequently altered in renal cell carcinoma (RCC).KRT19 was identified as one of the key biomarkers for distinguishing cholangiocarcinoma (CCA) and hepatocellular carcinoma.Expression of KRT19 was specifically high in breast cancers and significantly correlated with their invasiveness. Moreover, knockdown of KRT19 led to increased proliferation, migration, invasion, drug resistance, and sphere formation in breast cancer cells via an upregulated NOTCH signaling pathway.
Full Name
keratin 19, type I
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait