Pedido rápido

Text Size:AAA

Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano KXD1 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_024069.3
    Tamaño de cDNA:531bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens KxDL motif containing 1 with C terminal HA tag.
    Sinónimo de gen:KXDL, MST096, MSTP096, C19orf50
    Especie:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with KXD1 qPCR primers for gene expression analysis, HP105119 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG16369-ACG$225
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG16369-ACR$225
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG16369-ANG$225
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG16369-ANR$225
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG16369-CF$195
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG16369-CH$195
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG16369-CM$195
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG16369-CY$195
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(Vector de expresión)HG16369-G$75
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG16369-NF$195
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG16369-NH$195
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG16369-NM$195
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG16369-NY$195
    Human KXD1/C19orf50 Gene ORF cDNA clone in cloning vectorHG16369-U$75
    Humano KXD1/C19orf50 clonación del ADN o clonación génica(vector de clonación)HG16369-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG16369-CY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"