Pedido rápido

Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano L3MBTL3 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC060845
    Tamaño de cDNA:2268bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens l(3)mbt-like 3 (Drosophila) DNA.
    Sinónimo de gen:MBT1, MBT-1, RP11-73O6.1
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with L3MBTL3 qPCR primers for gene expression analysis, HP103857 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15231-ACG$245
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15231-ACR$245
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15231-ANG$245
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15231-ANR$245
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15231-CF$215
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15231-CH$215
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15231-CM$215
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15231-CY$215
    Humano L3MBTL3 clonación del ADN o clonación génica(Vector de expresión)HG15231-G$75
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15231-NF$215
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15231-NH$215
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15231-NM$215
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15231-NY$215
    Humano L3MBTL3 clonación del ADN o clonación génica(vector de clonación)HG15231-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG15231-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"