After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human LBP Información de producto de clon de cDNA
Gene_bank_ref_id:NM_004139.2
Tamaño de cDNA:1446bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens lipopolysaccharide binding protein with N terminal HA tag.
Sinónimo de gen:MGC22233
Especie:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10526-ACG$225
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10526-ACR$225
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10526-CF$195
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10526-CH$195
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10526-CM$195
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10526-CY$195
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(Vector de expresión)HG10526-M$75
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10526-M-F$195
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10526-NF$195
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10526-NH$195
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10526-NM$195
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10526-NY$195
Humano Lipopolysaccharide binding Proteína/LBP clonación del ADN o clonación génica(vector de clonación)HG10526-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Lipopolysaccharide binding protein ( LBP ) is a glycoprotein that is synthesized principally by hepatocytes. LBP is a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides ( LPSs ). LBP binds directly to the outer membrane of Gram-negative bacteria and to purified aggregates of extracted endotoxin, and catalyses the delivery of endotoxin to membrane ( mCD14,GPI-Linked ) and soluble ( sCD14 ) forms of CD14, thereby markedly increasing host cell sensitivity to endotoxin. LBP efficiently catalyses the transfer of individual molecules of endotoxin to (s)CD14 only when LBP–endotoxin aggregates are formed in the presence of albumin. In the presence of EDTA, LBP binding promotes further disaggregation of endotoxin. LBP binding does not have such drastic effects under more physiological conditions, but may still induce more subtle topological rearrangements of endotoxin.

Referencias
  • J. Weiss, 2003, Biochemical Society Transactions: Volume 31, part 4: 785-790.
  • RR Schumann, et al., Science, 1990, Vol 249, Issue 4975: 1429-143.
  • Carsten J. Kirschning, et al., 1997, Genomics, Volume 46, Issue 3: 416-25.
  • Size / Price
    Catálogo: HG10526-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"