Pedido rápido

Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano LIF Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_002309.4
    Tamaño de cDNA:609bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens leukemia inhibitory factor with N terminal Myc tag.
    Sinónimo de gen:CDF, DIA, HILDA, MLPLI
    Especie:Human
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LIF qPCR primers for gene expression analysis, HP103197 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14890-ACG$225
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14890-ACR$225
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14890-CF$195
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14890-CH$195
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14890-CM$195
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14890-CY$195
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(Vector de expresión)HG14890-G$75
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14890-NF$195
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14890-NH$195
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14890-NM$195
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14890-NY$195
    Humano Leukemia Inhibitory Factor/LIF clonación del ADN o clonación génica(vector de clonación)HG14890-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Leukemia inhibitory factor (LIF) is a pleiotropic glycoprotein belonging to the IL-6 family of cytokines. It’s involved in growth promotion and cell differentiation of different types of target cells, influence on bone metabolism, cachexia, neural development, embryogenesis and inflammation. LIF has potent proinflammatory property, being the inducer of the acute phase protein synthesis and affecting the cell recruitment into the area of damage or inflammation. LIF is also one of the cytokines that are capable to regulate the differentiation of embryonic stem cells, hematopoietic and neuronal cells. LIF binds to the specific LIF receptor (LIFR-α) which forms a heterodimer with a specific subunit common to all members of that family of receptors, the GP130 signal transducing subunit. This leads to activation of the JAK/STAT and MAPK cascades. Due to its polyfunctional activities, LIF is involved in the pathogenic events and development of many diseases of various origin.

    Referencias
  • Salas EM, et al. (2011) LIF, a Novel STAT5-Regulated Gene, Is Aberrantly Expressed in Myeloproliferative Neoplasms. Genes Cancer. 2 (5): 593-6.
  • Chodorowska G, et al. (2004) Leukemia inhibitory factor (LIF) and its biological activity. Ann Univ Mariae Curie Sklodowska Med. 59 (2): 189-93.
  • Garcia-Campana AM, et al. (2007) LIF detection of peptides and proteins in CE. Electrophoresis. 28 (1-2): 208-32.
  • Size / Price
    Catálogo: HG14890-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"