Pedido rápido

Text Size:AAA

Humano LILRA3/CD85e/ILT6 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human LILRA3 Información de producto de clon de cDNA
Tamaño de cDNA:1320bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens leukocyte immunoglobulin-like receptor, subfamily with C terminal Myc tag.
Sinónimo de gen:e3, HM31, HM43, ILT6, LIR4, CD85E, LIR-4, LILRA3
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano LILRA3/CD85e/ILT6 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Product nameProduct name

ILT6, also known as LILRA3, belongs to the ILT family. In human, the ILT gene family includes up to 11 members. The extracellular portion of all members includes at least two and usually four immuno-globulin domains. ILT-2 through 5 are all inhibitory members having variable numbers of cytoplasmic ITIM domains. ILT6 lacks a transmembrane domain. The function of ILT6 is currently unknown. however it is highly homologous to other LILR genes, and can bind human leukocyte antigen (HLA) class I. Therefore, if secreted, the ILT6 might impair interactions of membrane-bound LILRs (such as LILRB1, an inhibitory receptor expressed on effector and memory CD8 T cells) with their HLA ligands, thus modulating immune reactions and influencing susceptibility to disease.

  • Wi?niewski A, et al. (2004) Distribution of LILRA3 (ILT6 / LILRA3/LIR4) deletion in psoriatic patients and healthy controls. Hum Immunol. 64(4):458-61.
  • Norman PJ, et al. (2003) DNA sequence variation and molecular genotyping of natural killer leukocyte immunoglobulin-like receptor, LILRA3. Immunogenetics. 55(3):165-71.
  • Cella M, et al. (1997) A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J Exp Med. 185(10): 1743-51.
  • Size / Price
    Catálogo: HG13549-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.