LRPAP1 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

LRPAP1 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Description
Full length Clone DNA of Human low density lipoprotein receptor-related protein associated protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LRPAP1 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

A2MRAP cDNA ORF Clone, Human; A2RAP cDNA ORF Clone, Human; alpha-2-MRAP cDNA ORF Clone, Human; HBP44 cDNA ORF Clone, Human; MRAP cDNA ORF Clone, Human; MYP23 cDNA ORF Clone, Human; RAP cDNA ORF Clone, Human

LRPAP1 Background Information

Receptor-associated protein (RAP) is a molecular chaperone for low density lipoprotein receptor-related protein (LRP), which plays a key role in cholesterol metabolism. The lipoprotein receptor-related protein (LRP) is an endocytic receptor for several ligands, such as alpha2-macroglobulin (alpha2 M) and apolipoprotein E. LRP is involved in the clearance of lipids from the bloodstream and is expressed in the atherosclerotic plaque. The LRP-associated protein (LRPAP in humans, RAP in mice) acts as a chaperone protein, stabilizing the nascent LRP peptide in the endoplasmic reticulum and Golgi complex. Alpha-2-macroglobulin receptor-associated protein, also known as low density lipoprotein receptor-related protein-associated protein 1, RAP and LRPAP1, is a 39 kDa protein and a member of the alpha-2-MRAP family. It is a receptor antagonist that interacts with several members of the low density lipoprotein (LDL) receptor gene family. Upon binding to these receptors, LRPAP1 inhibits all ligand interactions with the receptors. LRPAP1 is present on cell surface forming a complex with the alpha-2-macroglobulin receptor heavy and light chains. It binds with LRP1B and the binding is followed by internalization and degradation. LRPAP1 interacts with LRP1/alpha-2-macroglobulin receptor and LRP2 (previously called glycoprotein 33), and may be involved in the pathogenesis of membrane glomerular nephritis. LRPAP1 together with LRP2 forms the Heymann nephritis antigenic complex. LRP2 is expressed in epithelial cells of the thyroid, where it can serve as a receptor for the protein thyroglobulin. Intron 5 insertion/deletion polymorphism of RAP gene (LRPAP1) has been implicated in other diseases sharing etiology with gallstone disease (GSD). The LRPAP1 insertion/deletion polymorphism influences cholesterol homeostasis and may confer risk for gallstone disease and gallbladder carcinoma (GBC) incidence usually parallels with the prevalence of cholelithiosis. The genetic variations at the LRPAP1 locus may modulate Alzheimer disease (AD) phenotype beyond risk for disease. In addition, the variation at the LRPAP1 gene could contribute to the risk of developing an early episode of myocardial infarction (MI).
Full Name
low density lipoprotein receptor-related protein associated protein 1
References
  • Gonzlez P, et al. (2002) Variation in the lipoprotein receptor-related protein, alpha2-macroglobulin and lipoprotein receptor-associated protein genes in relation to plasma lipid levels and risk of early myocardial infarction. Coron Artery Dis. 13(5): 251-4.
  • Schutte DL, et al. (2003) A LRPAP1 intronic insertion/deletion polymorphism and phenotypic variability in Alzheimer disease. Res Theory Nurs Pract. 17(4): 301-19?
  • Pandey SN, et al. (2006) Lipoprotein receptor associated protein (LRPAP1) insertion/deletion polymorphism: association with gallbladder cancer susceptibility. Int J Gastrointest Cancer. 37(4): 124-8.
  • Dixit M, et al. (2006) Association of low density lipoprotein receptor related protein-associated protein (LRPAP1) gene insertion/deletion polymorphism with gallstone disease.J Gastroenterol Hepatol. 21(5): 847-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait