LY6D cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

LY6D cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
387 bp
Description
Full length Clone DNA of Human lymphocyte antigen 6 complex, locus D with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LY6D cDNA ORF Clone, Human, N-Myc tag: Alternative Names

E48 cDNA ORF Clone, Human; Ly-6D cDNA ORF Clone, Human

LY6D Background Information

The expression of LY6D is induced in MCF1A cells by X-ray irradiation. The induction of LY6D expression is triggered through a pathway regulated by ATM, CHK2 and p53. This method is a new Ab-directed proteomic strategy for analysis of membrane proteins, and is applicable to various biological phenomena in situations in which both target molecule-expressing cells and nonexpressing cells are available.
Full Name
lymphocyte antigen 6 complex, locus D
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait