Pedido rápido

Text Size:AAA

Humano Lysozyme 2 / LYZL2 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano LYZL2 Información de producto de clon de cDNA
    Tamaño de cDNA:585bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens lysozyme-like 2 with N terminal Myc tag.
    Sinónimo de gen:LYZL2
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    ( We provide with LYZL2 qPCR primers for gene expression analysis, HP102403 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano Lysozyme 2 / LYZL2 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Product nameProduct name

    Lysozyme 2 gene is a member of a family of lysozyme-like genes. Lysozymes, especially C-type lysozymes, are well-recognized bacteriolytic factors widely distributed in the animal kingdom and play a mainly protective role in host defense. Lysozymes damage bacterial cell walls by catalyzing hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in a peptidoglycan and between N-acetyl-D-glucosamine residues in chitodextrins.

    Lysozyme is part of the innate immune system. Reduced lysozyme levels have been associated with bronchopulmonary dysplasia in newborns. In certain cancers (especially myelomonocytic leukemia) excessive production of lysozyme by cancer cells can lead to toxic levels of lysozyme in the blood. High lysozyme blood levels can lead to kidney failure and low blood potassium, conditions that may improve or resolve with treatment of the primary malignancy.

  • Lamesch P. et al., 2007, Genomics. 89 (3): 307-15.
  • Argyropoulos G. et al., 2009, Physiol Genomics. 36 (2): 79-88.
  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Size / Price
    Catálogo: HG13726-NM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.