MAGOH cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

MAGOH cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
441 bp
Description
Full length Clone DNA of Human mago-nashi homolog, proliferation-associated (Drosophila) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MAGOH cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

MAGOH1 cDNA ORF Clone, Human; MAGOHA cDNA ORF Clone, Human

MAGOH Background Information

MAGOH is the human homologue of Drosophila mago nashi, a protein that is required for normal germ plasm development in the Drosophila embryo.EJCs are deposited on messenger RNAs (mRNAs) during splicing and their core consists of eIF4A3, MLN51, Y14, and MAGOH.Both MAGOH proteins interact with other EJC components, incorporate into mRNA-bound EJCs, and activate nonsense-mediated decay.
Full Name
mago-nashi homolog, proliferation-associated (Drosophila)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait