Pedido rápido

Text Size:AAA

Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human MAP1LC3A Información de producto de clon de cDNA
Gene_bank_ref_id:BC015810
Tamaño de cDNA:366bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens microtubule-associated protein 1 light chain 3 alpha with N terminal Myc tag.
Sinónimo de gen:RP11-346K17.1, ATG8E, LC3, LC3A, MAP1ALC3, MAP1BLC3, MAP1LC3A
Especie:Human
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14322-ACG$225
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14322-ACR$225
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14322-ANG$225
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14322-ANR$225
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14322-CF$195
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14322-CH$195
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14322-CM$195
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14322-CY$195
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(Vector de expresión)HG14322-G$75
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14322-NF$195
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14322-NH$195
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14322-NM$195
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14322-NY$195
Humano LC3A/MAP1LC3A clonación del ADN o clonación génica(vector de clonación)HG14322-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

LC3A, also known as MAP1LC3A, is one of the light chain subunits that functions together with both MAP1A and/or MAP1B. MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. As a light chain subunit, MAP1LC3A has an important part in neuronal development and in maintaining the balance between neuronal plasticity and rigidity. MAP1LC3A is expressed as two alternatively spliced isoforms that are expressed in testis, brain, heart, liver and skeletal muscle, but are absent in thymus and peripheral blood leukocytes.

Size / Price
Catálogo: HG14322-NM
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"