After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human MAPK8 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_139047.1
Tamaño de cDNA:1284bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 8, transcript variant JNK1-b2 with N terminal Myc tag.
Sinónimo de gen:JNK, JNK1, PRKM8, SAPK1, JNK1A2, JNK21B1/2
Especie:Human
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10795-ACG$225
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10795-ACR$225
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10795-ANG$225
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10795-ANR$225
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10795-CF$195
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10795-CH$195
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10795-CM$195
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10795-CY$195
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(Vector de expresión)HG10795-M$75
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10795-M-F$195
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación)HG10795-M-N$195
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10795-NF$195
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10795-NH$195
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10795-NM$195
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10795-NY$195
Humano JNK1 / MAPK8 transcript variant JNK1-b2 clonación del ADN o clonación génica(vector de clonación)HG10795-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.

Referencias
  • Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.
  • Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.
  • Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.
  • Size / Price
    Catálogo: HG10795-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"