After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human MASTL Información de producto de clon de cDNA
Gene_bank_ref_id:NM_032844.2
Tamaño de cDNA:2637bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens microtubule associated serine/threonine kinase-like with N terminal His tag.
Sinónimo de gen:THC2, FLJ14813, RP11-85G18.2, MASTL
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10761-ACG$325
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10761-ACR$325
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10761-ANG$325
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10761-ANR$325
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10761-CF$295
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10761-CH$295
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10761-CM$295
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10761-CY$295
Humano MASTL/THC2 clonación del ADN o clonación génica(Vector de expresión)HG10761-M$75
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10761-M-F$295
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10761-NF$295
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10761-NH$295
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10761-NM$295
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10761-NY$295
Humano MASTL/THC2 clonación del ADN o clonación génica(vector de clonación)HG10761-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10761-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"