Pedido rápido

Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano MBP Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001025090.1
    Tamaño de cDNA:516bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens Myelin basic protein, transcript variant 3 with N terminal HA tag.
    Sinónimo de gen:MGC99675, MBP
    Especie:Human
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MBP qPCR primers for gene expression analysis, HP101074 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11167-ACG$225
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11167-ACR$225
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11167-CF$195
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11167-CH$195
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11167-CM$195
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11167-CY$195
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(Vector de expresión)HG11167-M$75
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11167-M-F$195
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación)HG11167-M-N$195
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11167-NF$195
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11167-NH$195
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11167-NM$195
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11167-NY$195
    Humano MBP/Myelin Basic Proteína transcript variant 3 clonación del ADN o clonación génica(vector de clonación)HG11167-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG11167-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"