Pedido rápido

Text Size:AAA

Humano Meteorin / METRN clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human METRN Información de producto de clon de cDNA
Tamaño de cDNA:882bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens meteorin, glial cell differentiation regulator with N terminal HA tag.
Sinónimo de gen:MGC2601, C16orf23, c380A1.2, METRN
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Meteorin / METRN clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Product nameProduct name

Meteorin is a novel secreted protein that is expressed in undifferentiated neural progenitors and in the astrocyte lineage, including radial glia. It plays important roles in the differentiation of glial cells and also in axonal network formation during neurogenesis. Meteorin selectively promoted astrocyte formation from mouse cerebrocortical neurospheres in differentiation culture, whereas it induced cerebellar astrocytes to become radial glia. Meteorin also induced axonal extension in small and intermediate neurons of sensory ganglia by activating nearby satellite glia.

  • Martin J, et al. (2004) The sequence and analysis of duplication-rich human chromosome 16. Nature. 432(7020):988-94.
  • Nishino J, et al. (2004) Meteorin: a secreted protein that regulates glial cell differentiation and promotes axonal extension. EMBO J. 23(9):1998-2008.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Size / Price
    Catálogo: HG13433-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.