Pedido rápido

Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano MID1IP1 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC008908
    Tamaño de cDNA:552bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens MID1 interacting protein 1 with C terminal His tag.
    Sinónimo de gen:S14R, MIG12, THRSPL, G12-like, STRAIT11499, MID1IP1
    Especie:Human
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MID1IP1 qPCR primers for gene expression analysis, HP102661 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14005-ACG$225
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14005-ACR$225
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14005-ANG$225
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14005-ANR$225
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14005-CF$195
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14005-CH$195
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14005-CM$195
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14005-CY$195
    Humano MID1IP1 clonación del ADN o clonación génica(Vector de expresión)HG14005-G$75
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14005-NF$195
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14005-NH$195
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14005-NM$195
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14005-NY$195
    Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación)HG14005-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    MID1IP1 belongs to the SPOT14 family. It is a homodimer in the absence of THRSP. MID1IP1 interacts with ACACA and ACACB. It plays a role in the regulation of lipogenesis in liver. It up-regulates ACACA enzyme activity. MID1IP1 is required for efficient lipid biosynthesis, including triacylglycerol, diacylglycerol and phospholipid. MID1IP1 is involved in stabilization of microtubules. Its interaction with THRSP interferes with ACACA binding.

    Referencias
  • Aipoalani DL. et al., 2010, Endocrinology. 151 (5): 2071-7.
  • Colbert CL. et al., 2010, Proc Natl Acad Sci. 107 (44): 18820-5.
  • Inoue J. et al., 2011, Mol Endocrinol. 25 (6): 995-1005.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"