After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human MID1IP1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC008908
Tamaño de cDNA:552bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens MID1 interacting protein 1 with C terminal His tag.
Sinónimo de gen:S14R, MIG12, THRSPL, G12-like, STRAIT11499, MID1IP1
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14005-ACG$225
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14005-ACR$225
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14005-ANG$225
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14005-ANR$225
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14005-CF$195
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14005-CH$195
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14005-CM$195
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14005-CY$195
Humano MID1IP1 clonación del ADN o clonación génica(Vector de expresión)HG14005-G$75
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14005-NF$195
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14005-NH$195
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14005-NM$195
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14005-NY$195
Humano MID1IP1 clonación del ADN o clonación génica(vector de clonación)HG14005-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

MID1IP1 belongs to the SPOT14 family. It is a homodimer in the absence of THRSP. MID1IP1 interacts with ACACA and ACACB. It plays a role in the regulation of lipogenesis in liver. It up-regulates ACACA enzyme activity. MID1IP1 is required for efficient lipid biosynthesis, including triacylglycerol, diacylglycerol and phospholipid. MID1IP1 is involved in stabilization of microtubules. Its interaction with THRSP interferes with ACACA binding.

Referencias
  • Aipoalani DL. et al., 2010, Endocrinology. 151 (5): 2071-7.
  • Colbert CL. et al., 2010, Proc Natl Acad Sci. 107 (44): 18820-5.
  • Inoue J. et al., 2011, Mol Endocrinol. 25 (6): 995-1005.
  • Size / Price
    Catálogo: HG14005-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"