Pedido rápido

Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano MIPOL1 Información de producto de clon de cDNA
Tamaño de cDNA:786bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens mirror-image polydactyly 1 with C terminal His tag.
Sinónimo de gen:MIPOL1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
( We provide with MIPOL1 qPCR primers for gene expression analysis, HP103785 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15158-ACG$225
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15158-ACR$225
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15158-ANG$225
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15158-ANR$225
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15158-CF$195
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15158-CH$195
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15158-CM$195
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15158-CY$195
Humano MIPOL1 clonación del ADN o clonación génica(Vector de expresión)HG15158-G$75
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15158-NF$195
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15158-NH$195
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15158-NM$195
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15158-NY$195
Humano MIPOL1 clonación del ADN o clonación génica(vector de clonación)HG15158-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15158-CH
Precio de lista: 
Precio:      (You Save: )
Añadir a carroBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.