After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano MMGT1 / EMC5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human MMGT1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC033588
Tamaño de cDNA:396bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens membrane magnesium transporter 1 with C terminal His tag.
Sinónimo de gen:EMC5, TMEM32, MMGT1
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fondo

MMGT1, also known as EMC5, is comparable with primary microglial cells with respect to morphology, presence of acetylated low density lipoprotein receptor, non-specific esterase, CD63, major histocompatibility complex antigens and CD11, and binding for Ricinus communis agglutinin. Primary microglia as well as MMGT1 cells are negative for glial fibrillary acidic protein. Different MMGT1 strains are obtained after subcloning, two of which resembled histiocytes (F4/80 and BM-8). These cell strains, MMGT12 and 16, are able to opsonize latex beads, and could be induced by endotoxins (LPS) to secrete TNF-alpha, IL-1, IL-6, TGF-beta, and EGF.

Referencias
  • Goytain A. et al., 2008, Am J Physiol Cell Physiol. 294 (2): C495-502.
  • Briers TW. et al., 1994, J Neuroimmunol. 52 (2): 153-64.
  • Jäger S. et al., 2011, Nature. 481 (7381): 365-70.
  • Size / Price
    Catálogo: HG13998-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"