Pedido rápido

Text Size:AAA

Humano MMP-3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human MMP3 Información de producto de clon de cDNA
Tamaño de cDNA:1434bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens matrix metallopeptidase 3 (stromelysin 1, progelatinase) with C terminal His tag.
Sinónimo de gen:SL-1, STMY, STR1, MMP-3, STMY1, MGC126102, MGC126103, MGC126104, MMP3
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Matrix metallopeptidase 3 (abbreviated as MMP3) is also known as stromelysin 1 and progelatinase. MMP3 is a member of the matrix metalloproteinase (MMP) family whose members are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, tissue remodeling, and disease processes including arthritis and metastasis. As a secreted zinc-dependent endopeptidase, MMP3 exerts its functions mainly in extracellular matrix. This protein is activated by two major endogenous inhibitors: alpha2-macroglobulin and tissue inhibitors of metalloproteases (TIMPs). MMP3 plays a central role in degrading collagen types II, III, IV, IX, and X, proteoglycans, fibronectin, laminin, and elastin. In addition, MMP3 can also active other MMPs such as MMP1, MMP7, and MMP9, rendering MMP3 crucial in connective tissue remodeling. Dysregulatoin of MMPs has been implicated in many diseases including arthritis, chronic ulcers, encephalomyelitis and cancer. Synthetic or natural inhibitors of MMPs result in inhibition of metastasis, while up-regulation of MMPs led to enhanced cancer cell invasion.

  • Sternlicht MD, et al. 1999, The stromal proteinase MMP3/stromelysin-1 promotes mammary carcinogenesis. Cell. 98(2): 137-46.
  • Yoon S, et al. (1999) Genetic analysis of MMP3, MMP9, and PAI-1 in Finnish patients with abdominal aortic or intracranial aneurysms. Biochem Biophys Res Commun. 265(2): 563-8.
  • Biondi ML, et al. (2000) MMP1 and MMP3 polymorphisms in promoter regions and cancer. Clin Chem. 46(12): 2023-4.
  • Size / Price
    Catálogo: HG10467-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.