After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human MORF4L2 Información de producto de clon de cDNA
Gene_bank_ref_id:BC056899
Tamaño de cDNA:867bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens mortality factor 4 like 2 DNA.
Sinónimo de gen:MRGX, MORFL2
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15249-ACG$225
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15249-ACR$225
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15249-ANG$225
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15249-ANR$225
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15249-CF$195
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15249-CH$195
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15249-CM$195
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15249-CY$195
Humano MORF4L2 clonación del ADN o clonación génica(Vector de expresión)HG15249-G$75
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15249-NF$195
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15249-NH$195
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15249-NM$195
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15249-NY$195
Humano MORF4L2 clonación del ADN o clonación génica(vector de clonación)HG15249-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15249-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"