Pedido rápido

Humano MRPL45 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human MRPL45 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_032351.4
Tamaño de cDNA:921bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens mitochondrial ribosomal protein L45.
Sinónimo de gen:L45mt, MRP-L45
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG16148-ACG$225
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG16148-ACR$225
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG16148-ANG$225
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG16148-ANR$225
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG16148-CF$195
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG16148-CH$195
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG16148-CM$195
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG16148-CY$195
Humano MRPL45 clonación del ADN o clonación génica(Vector de expresión)HG16148-G$75
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG16148-NF$195
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG16148-NH$195
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG16148-NM$195
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG16148-NY$195
Humano MRPL45 clonación del ADN o clonación génica(vector de clonación)HG16148-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG16148-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"