Pedido rápido

Text Size:AAA

Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human MRPS35 Información de producto de clon de cDNA
Tamaño de cDNA:972bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens mitochondrial ribosomal protein S35 with C terminal His tag.
Sinónimo de gen:MDS023, MRPS28, MRP-S28, HDCMD11P
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG16343-ACG$225
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG16343-ACR$225
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG16343-ANG$225
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG16343-ANR$225
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG16343-CF$195
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG16343-CH$195
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG16343-CM$195
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG16343-CY$195
Humano MRPS35 clonación del ADN o clonación génica(Vector de expresión)HG16343-G$75
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG16343-NF$195
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG16343-NH$195
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG16343-NM$195
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG16343-NY$195
Humano MRPS35 clonación del ADN o clonación génica(vector de clonación)HG16343-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG16343-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.