Pedido rápido

Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano MRTO4 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC003013
    Tamaño de cDNA:720bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens mRNA turnover 4 homolog (S. cerevisiae) with N terminal HA tag.
    Sinónimo de gen:MRT4, C1orf33, dJ657E11.4
    Especie:Human
    Vector:pCMV3-N-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MRTO4 qPCR primers for gene expression analysis, HP103273 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14639-ACG$225
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14639-ACR$225
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14639-ANG$225
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14639-ANR$225
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14639-CF$195
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14639-CH$195
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14639-CM$195
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14639-CY$195
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(Vector de expresión)HG14639-G$75
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14639-NF$195
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14639-NH$195
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14639-NM$195
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14639-NY$195
    Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación)HG14639-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    MRTO4, also known as MRT4, belongs to the ribosomal protein L10P family. MRTO4 is a ribosomal P0-like protein showing extensive sequence similarity to the ribosomal P0 protein. The precise function of MRTO4 is currently unknown. It appears to be involved in mRNA turnover and ribosome assembly. MRTO4 acts as a trans-acting factor which modulates the assembly of the pre-60S particle.

    Referencias
  • Zhao J. et al., 2011, J Proteomics. 75 (2): 588-602.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Wu Z. et al., 2012, PLoS One. 7 (8): e43997.
  • Michalec B. et al., 2010, Int J Biochem Cell Biol. 42 (5): 736-48.
  • Size / Price
    Catálogo: HG14639-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"