After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human MRTO4 Información de producto de clon de cDNA
Gene_bank_ref_id:BC003013
Tamaño de cDNA:720bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens mRNA turnover 4 homolog (S. cerevisiae) with N terminal HA tag.
Sinónimo de gen:MRT4, C1orf33, dJ657E11.4
Especie:Human
Vector:pCMV3-N-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14639-ACG$225
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14639-ACR$225
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14639-ANG$225
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14639-ANR$225
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14639-CF$195
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14639-CH$195
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14639-CM$195
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14639-CY$195
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(Vector de expresión)HG14639-G$75
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14639-NF$195
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14639-NH$195
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14639-NM$195
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14639-NY$195
Humano MRTO4 / MRT4 clonación del ADN o clonación génica(vector de clonación)HG14639-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

MRTO4, also known as MRT4, belongs to the ribosomal protein L10P family. MRTO4 is a ribosomal P0-like protein showing extensive sequence similarity to the ribosomal P0 protein. The precise function of MRTO4 is currently unknown. It appears to be involved in mRNA turnover and ribosome assembly. MRTO4 acts as a trans-acting factor which modulates the assembly of the pre-60S particle.

Referencias
  • Zhao J. et al., 2011, J Proteomics. 75 (2): 588-602.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Wu Z. et al., 2012, PLoS One. 7 (8): e43997.
  • Michalec B. et al., 2010, Int J Biochem Cell Biol. 42 (5): 736-48.
  • Size / Price
    Catálogo: HG14639-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"